Russ. J. Bioorganic Chem., 1997, 23(3):184-189

New allele-specific primers for detecting the Leiden mutation in exon 10 of the factor V gene in thrombophilia

New allele-specific primers were developed which enable the facile and effective identification of the Leiden mutation in the human genome using PCR. One of the primers (allele-nonspecific), which is complementary to the nucleotide sequence of the intron 10 sense strand, [(5′)TCTCTTGAAGGAAATGCCCCATTA], was described by B. Dahlback in 1994. Two other primers (allele-specific), (5′)TAAGAGCAGATCCCTGGACAGCCA and (5′)TAAGAGCAGATCCCTGGACACGCA, contained a 3′-terminal nucleotide corresponding to the nucleotide of the mutant allele, as well as a nucleotide noncomplementary to the template DNA near the 3′-end (shown by boldface type). When used in combination with allele-nonspecific primers, both allele-specific primers were equally effective in detecting the Leiden mutation in the human factor V gene. Using these primers, two Leiden mutations in the heterozygous state were found in 20 patients with deep vein thromboses and pulmonary thromboembolism. © 1997 MAEe cyrillic signK Hayκa/Interperiodica Publishing.

Zykova ES, Patrushev LI, Kayushin AL, Korosteleva MD, Miroshnikov AI, Bokarev IN, Leontev SG, Koshkin VM, Severin ES

IBCH: 2400
Кол-во цитирований на 04.2025: 0
Информация пока не проверена модераторами