New Allele-Specific Primers for Detecting the Leiden Mutation in Exon 10 of the Factor V Gene in Thrombophilia
Это дубликат статьи: «New allele-specific primers for detecting the Leiden mutation in exon 10 of the factor V gene in thrombophilia»
New allele-specific primers were developed which enable the facile and effective identification of the Leiden mutation in the human genome using PCR. One of the primers (allele-nonspecific), which is complementary to the nucleotide sequence of the intron 10 sense strand, [(5′)TCTCTTGAAGGAAATGCCCCATTA], was described by B. Dahlback in 1994. Two other primers (allele-specific), (5′)TAAGAGCAGATCCCTGGACAGCCA and (5′)TAAGAGCAGATCCCTGGACACGCA), contained a 3′-terminal nucleotide corresponding to the nucleotide of the mutant allele, as well as a nucleotide noncomplementary to the template DNA near the 3′-end (shown by boldface type). When used in combination with allele-nonspecific primers, both allele-specific primers were equally effective in detecting the Leiden mutation in the human factor V gene. Using these primers, two Leiden mutations in the heterozygous state were found in 20 patients with deep vein thromboses and pulmonary thromboembolia.
: 9190792

