Bioorg Khim, 1997, 23(3):210

New Allele-Specific Primers for Detecting the Leiden Mutation in Exon 10 of the Factor V Gene in Thrombophilia

Это дубликат статьи: «New allele-specific primers for detecting the Leiden mutation in exon 10 of the factor V gene in thrombophilia»

New allele-specific primers were developed which enable the facile and effective identification of the Leiden mutation in the human genome using PCR. One of the primers (allele-nonspecific), which is complementary to the nucleotide sequence of the intron 10 sense strand, [(5′)TCTCTTGAAGGAAATGCCCCATTA], was described by B. Dahlback in 1994. Two other primers (allele-specific), (5′)TAAGAGCAGATCCCTGGACAGCCA and (5′)TAAGAGCAGATCCCTGGACACGCA), contained a 3′-terminal nucleotide corresponding to the nucleotide of the mutant allele, as well as a nucleotide noncomplementary to the template DNA near the 3′-end (shown by boldface type). When used in combination with allele-nonspecific primers, both allele-specific primers were equally effective in detecting the Leiden mutation in the human factor V gene. Using these primers, two Leiden mutations in the heterozygous state were found in 20 patients with deep vein thromboses and pulmonary thromboembolia.

Zykova ES, Patrushev LI, Kayushin AL, Korosteleva MD, Miroshnikov AI, Bokarev IN, Leontev SG, Koshkin VM, Severin ES

IBCH: 2399
Кол-во цитирований на 04.2025: 4
Информация пока не проверена модераторами